• Log in with Facebook Log in with Twitter Log In with Google      Sign In    
  • Create Account
  LongeCity
              Advocacy & Research for Unlimited Lifespans

Photo

Genetic Singularity Event: CRISPR editing

singularity event genetic singularity singularity

  • Please log in to reply
219 replies to this topic

#61 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 25 November 2015 - 10:25 PM

ceridwen, would you (if you could) try CRISPR now to treat your cognitive impairment?

 

Widespread bipartisan support has been reached in the US for the notion that patients with serious medical issues have a Right to Try treatments they feel would be in their best interests.

This is now the law of the land in much of America. Similar legislation is in motion in the UK.

 

Considering you are currently coping with a medically difficult circumstance and still retain mental competency, I would be very interested whether you might exercise such a legal right regarding

a possible CRISPR treatment of your illness? Would you consider the recent research published demonstrating precise and perfect gene editing at any location in the genome to be sufficiently safe

to try? (Of course, any of target effects would probably be somewhat predictable, if one were to simply BLAST the genome for similar genome segments as in the CRISPR system. I suppose the

next step in development might be to add another correction mechanism to virtually eliminate the possibility of error.)

 

For example, delay of onset of dementia by almost 7 years has been demonstrated with homozygous carriers of a variant at rs1129844.

A pharmaceutical treatment is in the works based on this idea, though is many years away.

Would you want to CRISPR rs1129844 now?


Edited by mag1, 25 November 2015 - 10:30 PM.


#62 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 25 November 2015 - 10:48 PM

It seems that gene editing has already been used in the clinic to successfully treat childhood cancer.

Does anyone know whether official clinical trials have started?



Click HERE to rent this GENETICS advertising spot to support LongeCity (this will replace the google ad above).

#63 ceridwen

  • Guest
  • 1,292 posts
  • 102 ₮

Member Away
  • Location:UK
  • ✔

Posted 25 November 2015 - 11:43 PM

Yes I would like to try CRISPER but Drs in UK have been told not to refer patients to specialists and I'd have to know more about it like how much it costs for instance

#64 niner

  • Guest
  • 16,276 posts
  • 2,000 ₮
  • Location:Philadelphia

Posted 25 November 2015 - 11:43 PM

ceridwen, would you (if you could) try CRISPR now to treat your cognitive impairment?

 

[...]

 

For example, delay of onset of dementia by almost 7 years has been demonstrated with homozygous carriers of a variant at rs1129844.

A pharmaceutical treatment is in the works based on this idea, though is many years away.

Would you want to CRISPR rs1129844 now?

 

What's the point, given that this treatment doesn't exist?  I'm sure that ceridwen would be happy to try anything that was likely to work and not be harmful.  A drug based on this SNP might be available before a practical genetic therapy exists.  It might be the case that changing the gene would only work if done early in life.


  • Informative x 1

#65 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 26 November 2015 - 02:43 AM

I was interested in how someone facing the real and imminent prospect of Alzheimer's dementia would weigh the risk versus rewards given the 

current published state of the art. Governments around the world have indicated a willingness to allow people greater treatment freedom.

Right to Try has become a legally enshrined principle in parts of the world.

 

Given this, the opinion of someone in such a circumstance seemed far more pertinent than those who would impose regulatory restrictions.

 

As mentioned above, apparently a TALEN gene editing therapy treatment has already cured a child of leukemia.

Gene editing has already had clinical success.

It would seem that this broad treatment class does exist.

The treatment was shown to be safe and effective.

 

After reading some of the back stories on this, I realize that most of those in the know were tuned into this several years ago.

The development pipeline for CRISPR is very impressive.

From what I have read, there are multiple next generation implementations of CRISP, so it should now be considered essentially perfected.

 

Perhaps the upcoming International conference could give a technological appraisal.

 

When the embryo editing story appeared in April, it was clear that the technology had serious flaws.

This is no longer clear.

Publication of an article describing the second attempt at embryo editing with state of the art technology will be greatly anticipated.

 



#66 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 26 November 2015 - 03:05 AM

Our family's "genetic singularity event" has already occurred.

 

Our loved one is epsilon 33 and so should be at quite low risk of AD. 

This is the risk assessment given to us by 23andme.

However, there is a familial dominant history of dementia in our family.

 

During the past several centuries, our family has probably required substantial oversight

by the medical, legal and financial professions.

An entire infrastructure has developed in order to help us through our lives.

 

We are very grateful for all the help that we have received.

 

However, this help will no longer be required for future generations.

We already have gathered significant insights from an exome scan into possible mechanisms that have caused the dementia.

CRISPR would not even be required to prevent further members from developing dementia: simple reproductive selection would be sufficient.

Our family would then be substantially less likely than average to develop dementing illness.

 

This observation is likely true for the half of dementia families without an epsilon 4 allele.

It would also be true for a vast number of others with various genetic illness.

 

A genetically selectable future has already arrived.

 



#67 sthira

  • Guest
  • 2,008 posts
  • 406 ₮

Posted 26 November 2015 - 03:38 AM


A genetically selectable future has already arrived.


Where do we sign up? My bags are packed

#68 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 26 November 2015 - 03:46 AM

By that I meant available technology to prevent dementia in my family IS already here.

It is simply the reproductive selection technology that has been in use for decades.

 

Without genomic technology we could never have figured out our family's risk variants for dementia.

Now we can.

With an exome scan any family with such health issues would be in the same position.

 

A genetically editable future has not already arrived.

 


Edited by mag1, 26 November 2015 - 03:48 AM.


#69 sthira

  • Guest
  • 2,008 posts
  • 406 ₮

Posted 26 November 2015 - 04:09 AM

What does "reproductive selection technology" mean? Before copulating demand epsilon 33 results?

Edited by sthira, 26 November 2015 - 04:10 AM.


#70 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 26 November 2015 - 04:18 AM

Our family member is epsilon 33, though has a strong history of Alzheimer's dementia.

However, there were other genome variants discovered by the exome scan that appear to have contributed to the dementia risk.

No other close family member is affected.

 

Preventing future dementia in our family would be as simple as pre-implantation screening.

We have found several dementia reducing variants in our loved one's exome.

Future generations should be at quite low risk.

 

Many other at risk families could use a similar approach to eliminate future disease risk.

 

In a very real sense, CRISPR is hardly even necessary to prevent future illness in our family.

CRISPR will be entirely about editing in enhancements.

 

 


Edited by mag1, 26 November 2015 - 04:24 AM.


#71 ceridwen

  • Guest
  • 1,292 posts
  • 102 ₮

Member Away
  • Location:UK
  • ✔

Posted 26 November 2015 - 01:34 PM

This is a little off topic but have you tried Saint Johns Wort on your loved one? I read a report in Science Daily this year that said Saint John's Wort can help late stage dementia so that people who used to be able to do nothing after trying it could do something not much but something

#72 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 27 November 2015 - 12:48 AM

Thank you for the suggestion.

 

We would tend to stay away from adding in extras now because we have been having troubles with seizures.

Seizing is quite common in Alzheimer's, the commonly prescribed AD medications can make it worse.

The seizure subtext was why we pushed our doctor to prescribe the Keppra, and we have now brought the dosing down to the recently published

clinical trial using low doses in dementia.

 

If we were in your position, we might be preparing for a trip to China sometime in the nearish time horizon.

Probably best to wait and see for a while, there appears to be a global CRISPR gold rush on.

Would want to see what the first round of results are like.

Alzheimer's is probably near the top of the list.

 

You do not want to be put in the same position that are our loved one was in.

Not long after losing legal mental competence we started receiving pressure from our family doctor to withhold basic medical care.

 

We needed to go through multiple rounds of palliative care consults before a feeding tube would be inserted.

Our government is so broke that they have had to make recent legal changes to what is considered to be ethically minimum medical

practice. Many of these procedures were until recently done automatically, even without requiring the family's consent.

 

Our family doctor has told us directly that our family member is not a valid human being and would not be allowed to continue

living if placed into a professional care environment.

 

You need to determine what your government's position regarding the validity of your life.

There is all sorts of fancy talk, though if it comes down to your government having no particular interest in your well-being, then perhaps

a trip to China starts to make a whole lot of sense. The moral legitamacy of your government would obviously then be zero.

 

 



#73 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 27 November 2015 - 02:16 AM

Those people that have co-evolved with the dementia families can be thought of as a symbiont sub-species of humanity, perhaps called the Helpers.

With dementing illness, help was needed at almost every point in our lives.

As the cognitive impairment worsened, the level of care needed from the community greatly increased.

 

These Helpers needed to be of above average intelligence and caring.

They filled a variety of roles of cognitively complex roles, many of which required substantial training and insight.

Many of these roles were within the context of government services, such as medical care, legal etc. .   

 

 

By genetically selecting against dementia, it is likely that we will no longer require much, if any help to navigate our lives.

Keys please, and see ya. This likely applies to much of the disability community. Fairly basic reproductive technology that

has been available for many decades is set to radically reshape the 21st century. CRISPR is not needed for this.

The big enabler of this is the current generation of genomics technology. It has only been fairly recently that it became

possible to truly unlock the genome.

 

It is not entirely clear what role these Helpers will play in the future.

It is troubling to consider a world in which there were not a group designated as those who care and help others.

However, by genetically selecting against those who would actually need help, it might become inevitable to live in a world without carers.

 

Without this requirement, governments in the 21st Century might take a large step to the right.

I have thought about this quite a bit and I can not think of any helping service that our family would actually require if dementia were not present.

However, with dementia there is a virtually endless list of needs.

 

 



#74 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 27 November 2015 - 02:30 AM

Notably, removing the dementia risk variants will not just move our family to normal: we will overshoot to above normal.

This would not be the intent, though it would be the result.

Removing the risk variants while keeping the protective variants would inevitably create such an outcome.

 

Our family has several protective genetic variants, quite a few of which supposedly are fairly potent.

Their positive influence is only being masked by the risk variants.

Apparently, we will go from being part of a million year old dementia underclass to being significantly protected against dementia.

 

It would not be unexpected that a keeping up with the neighbors genetic arms race could then ensue.

In order for others to remain at their relative position in the community they would need to try their own genetic engineering.

The obvious problem is that for many people already near the top of the pyramid there might not be any particular selection they could do that would improve their

relative position. They already have won the genetic lottery. In such a circumstance the pressure to CRISPR would probably become intense.

 


Edited by mag1, 27 November 2015 - 02:45 AM.


#75 ceridwen

  • Guest
  • 1,292 posts
  • 102 ₮

Member Away
  • Location:UK
  • ✔

Posted 27 November 2015 - 04:21 AM

What is happening in China?
I have already been turned away by the receptionist at the Drs when I 1st became ill.

#76 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 27 November 2015 - 05:34 PM

ceridwen, China appears to be the most aligned to the new reality of CRISPR.

This new technology is a great fit for them socially, economically, culturally and technologically.

It is the old story those that want to leap ahead need to be innovative.

 

 

The UK also seems to be a progressive on genetic technology.

They have shown significant leadership.

It is not that surprising that the recent announcement of curing incurable childhood cancer with gene editing was from the UK.

 

What is your MMSE score?

Your optimal strategy largely depends on how far advanced your cognitive impairment might be.

If this were simply early subjective memory complaint, then you could just wait it out for a few years and let the science move ahead.

 

By the way, the international CRISPR conference will be held in Washington between December 1st and 3rd.

This is going to be absolutely fascinating!

Published articles have already described nearly perfected CRISPR technologies.

 

What research is in the pipe known by the research leaders?

What legally binding positions will the attending nations agree to?

 

 

 

 

 

 

 

 

 


Edited by mag1, 27 November 2015 - 05:36 PM.


#77 Danail Bulgaria

  • Guest
  • 2,224 posts
  • 421 ₮
  • Location:Bulgaria
  • ✔

Posted 27 November 2015 - 08:48 PM

I have maybe a strange question, but if you want to change a gene in your body, how will you do it in all of the cells? 


  • Good Point x 2

#78 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 27 November 2015 - 10:36 PM

Yes, this is a very valid point.

 

In one of the articles only a smallish number of cells were altered by CRISPR, though this was sufficient to achieve a therapeutic cure.

There are not many technical points that need to be worked through, though perhaps this might be one of them.

It is also not entirely clear how CRISPR would make it into the brain.

 


  • Good Point x 1

#79 Danail Bulgaria

  • Guest
  • 2,224 posts
  • 421 ₮
  • Location:Bulgaria
  • ✔

Posted 27 November 2015 - 11:15 PM

To tell the true, I dont know anything about that CRISPR.

 

As far as I understood, it is a natural defensive mechanism of the procaryotic cells, that has been harvested from scientists, and it can be used now to cut out parts of the human DNA at design locations, and to replace them with artifitially edited DNA segments. In order this to be done, however, it is needed in the cell to be inserted a Cas9 protein and an appropriate guide RNAs. 

 

This sounds sophisticated and expensive enough if only for a single cell, how about the cells of an entire organ? Won't it be too expensive? 

 


  • Good Point x 1
  • Agree x 1

#80 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 28 November 2015 - 02:23 PM

Becoming overly involved in the technical details of the technology greatly obscures the truly profound implications of CRISPR.

CRISPR is a naturally occurring process that has already been invented and perfected for us through natural selection.

Mother Nature is the true inventor and rightful patent holder of this technology.

Humans likely would not have been able to create a similar technology from the ground up for decades.

 

The question to ask yourself is: What would happen if genetics could be changed?

 

Taking a wide focus on the overall landscape of this technology and abstracting away the current implementations allows one to have

a clearer perspective. This is how the scientific community interpreted this technology 3 years ago. Substantial resources were committed

on the basis of the first round of discovery. We are now already experiencing a substantial first wave of applications.

 

In this vein of thought it is interesting to speculate what might happen if a CRISPR-CAS gene were inserted into the human genome.

Of course there could be truly terrifying consequences if something were to go awry. For example, in such a setting any passing virus or bacteria

might become incorporated into one's DNA. However, one could then also imagine an extraordinary new lifestyle in which one could constantly

have control over one's gene expression. Real time control over what proteins are expressed and how. This would simply turbo-charge the basic

CRISPR setup.

 

Genetics is a compromise. Alleles that might confer an advantage for intelligence at one stage of development often confer a deficit at another.

With real time genetic control, such compromises would not need to be made.

 

It is important to remember that there are already similar technologies.

CRISPR is just so much easier and so much cheaper.

It is a basic technology that requires minimal training and can be done over a few days.

 

A DIY kit is being promoted on the internet.

One of the only ingredients needed is $30 worth of RNA guide.

 

It is not entirely clear how a research moratorium could be imposed on such a technology.

Many other technologies that were not so simple and cheap have been managed before, though this one seems completely

unregulatable.

 

 

CRISPR is already profoundly reshaping the research landscape.

Imagine having primates as lab models instead of mice.

Having the right model means everything.

It is not difficult to expect that a wave of medical innovation is already in the pipe.

 

Almost every human illness has been cured hundreds of times over in mice models.

However, these mouse models have time and time again been shown not to translate well into humans.

With CRISPRed primate models available medical treatment should emerge nearly immediately.

 


Edited by mag1, 28 November 2015 - 02:39 PM.

  • Enjoying the show x 1

#81 Danail Bulgaria

  • Guest
  • 2,224 posts
  • 421 ₮
  • Location:Bulgaria
  • ✔

Posted 28 November 2015 - 02:39 PM

What kind of genetic therapies has been made on adult people?

 

What was their success?



#82 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 28 November 2015 - 02:41 PM

The first report of using gene editing was announced a few weeks ago.

 

A child was cured of incurable cancer. 



#83 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 28 November 2015 - 02:49 PM

I think this is one of those times that the popular perception of a technology greatly lags the current state of the art.

The scientific community expressed astonishment with this technology 3 years ago.

 

There are now reports emerging of a wave of CRISRPed animals.

Want a CRISPRed pet?

An entire CRISPR economy is already set for roll out next year.

 

Mainstream perception of CRISPR is years out of date.

 

When you scan the media landscape ask yourself: 

Do these stories in any way relate to the new reality of a CRISPR world? 

Much of the behavioural that is currently being demonstrated by homo sapiens appears highly delusional.

Denial?


  • Enjoying the show x 1

#84 Danail Bulgaria

  • Guest
  • 2,224 posts
  • 421 ₮
  • Location:Bulgaria
  • ✔

Posted 28 November 2015 - 03:33 PM

Maybe in all of the sciences the popular perception lags the current state. I agree that my knowledge in genetics is outdated.

 

Yet, I still cant imagine how a gene will be changed in an entire organ. I always have been imagining new organ made from stem cells to be transplanted on the place of the old one.



#85 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 28 November 2015 - 04:04 PM

Knowing things to be true that are untrue, is likely worse than not knowing things at all!

It might take decades for people to be re-educated in the new science of CRISPR genetics.

 

Such is always true with technology.

It is not truth: it is only the latest generation of an approximation.

 

Here are a few questions to work through in 21st genetics:

 

1. What percentage of intelligence can be attributed to genetics and how much to environment?

Answer: 100% Environment

 

2. Are there group differences in intelligence?

Answer: No

 

3. Can you make a reasonable prediction of someone's life trajectory given that person's genetic starting point?

Answer: No.

 

 

In some of the early attempts, the infection rate by CRISPR has been quite modest.

However, even with a small percentage of cells changed, this was still enough to effect a cure of a liver disease.

(It was probably helpful that the liver was the target as the healthy CRISPRed cells were able to replace diseased cells.)

 

Think of CRISPR as a virus. A virus can spread through many cells of the body, while also using the body's genetic machinery

to make more of the viral genome. I do not know exactly what would happen if one were to receive 1000s of units of CRISPR

in a given cell. I would really wonder about gene dosing.

 

All of these complications could be avoided if germline CRISPRing were done.   

 


  • Ill informed x 1

#86 Danail Bulgaria

  • Guest
  • 2,224 posts
  • 421 ₮
  • Location:Bulgaria
  • ✔

Posted 28 November 2015 - 05:55 PM

I still believe more in the stem cells technologies.

 

We have some differences in the points of view, this maybe is good for viewing the object from different angles and for the development of different ideas. :)

 

Here is a piece of my view:

 

1. What percentage of intelligence can be attributed to genetics and how much to environment?

Answer: NOT 100% Environment

Genetics definately plays role in intelligence. There are genetic disorders, that manifest with brain retardation, such as the Down syndrome. No matter in what environment you will place the majority of these children, and how many efforts from specialists you will invest in teaching them, they will never get an university degree. So, it definately is not 100% environment.

 

2. Are there group differences in intelligence?

Answer: Yes :)

There are differences even further. Not only among groups, but also among pople whithin one and the same group.

 

3. Can you make a reasonable prediction of someone's life trajectory given that person's genetic starting point?

Answer: Yes in some cases.

You can predict if one will die sooner from a cancer or from juvenile atherosclerosis.



#87 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 28 November 2015 - 06:37 PM

I was totally unprepared for CRISPR.

 

This seems like something that has just fallen out of the sky without warning.

 

Sure there was science fiction, though I am not sure that anything immediately springs to mind that might explain where we are now heading.

(Yet, I can see some clear similarities between the Eloi and Morlocks and modified and unmodifieds. H.G. was very perceptive. Many of the families that

we know that did not have a strong familial pattern of dementia appeared to have no idea what it meant to care for their loved ones. They had never

learned what this meant. A future without dementia simply might mean a future without caring or medicine. This is exactly how the Eloi behaved. Probably good

idea for the forum to realize that without Morlocks around, the quest for immortality might be fairly hopeless with only Eloi.)

 

What I was trying for with my questions was asking: What would the answers be with CRISPR?

   

Assuming genetics can be changed to whatever one wants, environment is all that remains.

The nature-nurture argument can finally be retired.

 

Group differences also disappear.

 

The idea that you have any predictive power with any initial genetic starting point also vanishes.

As has been mentioned, at every point up 'til now it would have been possible to make reasonably accurate projections

of the developmental trajectory of an individual, community or the world`, possibly out as much as several decades.

 

Assuming CRISPR implementation, this is no longer true.

Psychometrics no longer has predictive accuracy.

Our internal psychometricians should not be trusted.

 

I had some reasonably plausible mental images of what the 22nd Century might be like.

With CRISPR, I have no conception of what the future might hold.

 

Unlearning deeply preserved human tendencies will require some exertion.

The answers that have been thought to be true have now become uncertain and possibly untrue.

Instead of relying strictly on what is true at this moment, it would be much more

useful to wonder what soon might.

The people who persist in non-adaptive ancestral thinking will create a

substantial  burden on the community.

 

 

We already have the necessary technology to unlock the genetics of human intelligence.

The Singularity event might be much closer than we had imagined.

 

 

 

 


  • Enjoying the show x 1

#88 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 29 November 2015 - 07:48 PM

This tool shows what the off targets might be for a CRISPRing.

Could go to dbsnp, choose a SNP, copy and paste this information into the below url.

 

So, you would have some idea what off targets might result if you wanted to dramatically reduce your risk of 

Alzheimer's with the APP variant or the APOE epsilon 3b genotype. CRISPR would probably give you a homozygote

genotype so it would be even better than what has been typically reported for the heterozygotes.

 

The recent CRISPR article reduced the rate of off targets by 100 fold.

Almost none of the reported off targets from the below url would now apply.

 

This shows that a rational decision making process could be used to determine whether CRISPRing would

result in a favorable result. This would be known before any treatment were undertaken. The off targets

are the primary risk of the CRISPR procedure.

 

crispr.mit.edu


Edited by mag1, 29 November 2015 - 08:03 PM.

  • Informative x 1

#89 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 30 November 2015 - 10:26 PM

You can run another set of CRISPR prediction tools on the below url.

The below url contains the determining SNP for epsilon 4 genotype.

CRISPRing the red SNP in the below url rs429358 would greatly reduce the

rate of Alzheimer's.

 

Click VIEW-->In External Tools-->click CRISPOR.

This tool gives an RNA guide that is right at the epsilon 4 determining SNP ( number 37 on the output.)

It occurs at the second T of the "TGTG" sequence near the end of the number 37 sequence.

epsilon 4 which greatly increases the risk of Alzheimer's and is the ancestral genotype is partly caused by a T-->C at the second T.

 

37 / fw GCGGACATGGAGGACGTGTG CGG

14 off targets in genes.

 

Might someone confirm that this is correct?

 

http://genome.ucsc.e...4SbS0AEqXj9pUQd


Edited by mag1, 30 November 2015 - 10:28 PM.


Click HERE to rent this GENETICS advertising spot to support LongeCity (this will replace the google ad above).

#90 mag1

  • Topic Starter
  • Guest
  • 1,108 posts
  • 138 ₮
  • Location:virtual

Posted 30 November 2015 - 10:58 PM

The International Summit on Gene Editing starts tomorrow in Washington.

This is going to be very very interesting!

 

The media coverage on the recent article on a perfecting of CRISPR technology seemed quite light.

I am waiting very anxiously to see how the upcoming meeting will now frame CRISPR and how mainstream media will present the current

state of the art of CRISPR technology.  


Edited by mag1, 30 November 2015 - 10:59 PM.






Also tagged with one or more of these keywords: singularity event, genetic singularity, singularity

1 user(s) are reading this topic

0 members, 1 guests, 0 anonymous users